Review



2313a dntp neb cat  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    New England Biolabs 2313a dntp neb cat
    2313a Dntp Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2095 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2313a+dntp+neb+cat/Deoxynucleotide+(dNTP)+Solution+Mix/pm31813651-245-41-43
    Average 99 stars, based on 2095 article reviews
    2313a dntp neb cat - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Continuous and Discrete Neuron Types of the Adult Murine Striatum.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Hibernate-A Medium ThermoFisher Cat#A1247501 Trypsin inhibitor from chicken egg white Sigma Cat#T9253-500MG Percoll Sigma Cat#P1644 DAPI (4’,6-Diamidine-20-phenylindole dihydrochloride) Sigma Cat#10236276001 Triton X-100 Sigma Cat#T8787 Betaine Sigma-Aldrich Cat#61962 Recombinant RNase inhibitor Clontech Cat2313A dNTP NEB Cat#N0447 SMARTScribe Reverse Transcriptase Clontech Cat#639538 DTT (dithiothreitol) ThermoFisher Cat#R0861 Lambda Exonuclease NEB Cat#M0262L RNase-away ThermoFisher Cat#10328011 Critical Commercial Assays RNAscope Fluorescent Multiplex Reagent Kit ACDBio Cat#320850 Papain Dissociation System Worthington Cat#LK003150 Nextera XT DNA Library Prep Kit Illumina Cat#FC-131-1024 KAPA Hifi HotStart ReadyMix Kapa Biosystems Cat#KK2602 Ampure XP beads Ampure XP beads Cat#A63880 BioAnalyzer High Sensitivity Chips Agilent Cat#5067-4626 Falcon Cell Strainers Fisher Cat#08-771-2 ERCC RNA Spike-In Mix Invitrogen Cat#4456740 Cryomold VWR Cat#15160-215 Deposited Data Mouse Brain Atlas Allen Institute http://mouse.brain-map.org/ Mouse Reference Genome GRCm38/mm10 UCSC Genome Browser http://genome.ucsc.edu/cgi-bin/ hgGateway?db=mm10 Raw and analyzed data This paper GEO: GSE139412 Experimental Models: Organisms/Strains Mouse: FVB.Cg-Tg(Drd1-tdTomato)5Calak/ Mmnc Mus musculus Malenka Laboratory RRID:MMRRC_030512-UNC Mouse: Wildtype: C57BL/6J Jackson Laboratory JAX: #000664 Mouse: Tg(Drd2-EGFP)S118Gsat/Mmnc Malenka Laboratory RRID:MMRRC_000230-UNC Oligonucleotides Template Switch Oligo (AAGCAGTGGTATCAACG CAGAGTGAATrGrG+G) IDT Picelli et al., 2014 IS_PCR primer (AAGCAGTGGTATCAACGCAGAGT) IDT Picelli et al., 2014 Oligo dT: (50-AAGCAGTGGTATCAACGC AGAGTACT30VN-30) IDT Picelli et al., 2014 RNAscope Mm-Tac1 probe ACD Biosciences Cat#410351 RNAscope Mm-Penk probe ACD Biosciences Cat#318761 RNAscope Mm-Tac2 probe ACD Biosciences Cat#446391 RNAscope Mm-Nxph4 probe ACD Biosciences Cat#489641 (Continued on next page) Neuron 105, 1–12.e1–e8, February 19, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNAscope Mm-Cnr1 probe ACD Biosciences Cat#420721 RNAscope Mm-Crym probe ACD Biosciences Cat#466131 RNAscope Mm-Sema5b probe ACD Biosciences N/A RNAscope Mm-Id4 probe ACD Biosciences Cat#447861 RNAscope Mm-Nts probe ACD Biosciences Cat#420441 RNAscope Mm-Synpr probe ACD Biosciences Cat#500961 RNAscope Mm-Dner probe ACD Biosciences Cat#413951 RNAscope Mm-Tnnt1 probe ACD Biosciences Cat#466911 RNAscope Mm-Cxcl14 probe ACD Biosciences Cat#459741 RNAscope Mm-Th probe ACD Biosciences Cat#317621 RNAscope Mm-Htr7 probe ACD Biosciences Cat#401321 RNAscope Mm-Kremen1 probe ACD Biosciences Cat#425771 Software and Algorithms Star v2.4.0, https://github.com/alexdobin/STAR HTSeq v0.11.1, https://htseq.readthedocs.io/ en/release_0.11.1/ R v3.5.1, http://www.r-project.org; RRID:SCR_001905 Python v3.6.6, https://www.python.org Scanpy v1.3.7, https://icb-scanpy.readthedocs- hosted.com/en/stable/ CellProfiler v2.2.1, https://cellprofiler.org/releases/ Seurat v2.3.4, https://satijalab.org/seurat/ spdep v1.1-3, https://cran.r-project.org/web/ packages/spdep/index.html Fiji ImageJ Open source https://fiji.sc/ N/A Samtools N/A v1.3, http://samtools.sourceforge.net/; RRID:SCR_002105 Integrative Genomics Viewer (IGV) N/A http://software.broadinstitute.org/ software/igv; RRID:SCR_011793 Other FACS (Aria II) BD Biosciences N/A NextSeq 500 Illumina N/A Leica CM 3050 S cryostat Leica N/A HybEZ II Hybridization System for Manual Assays ACDBio N/A

    Reverse Transcription:

    Article Title: Continuous and Discrete Neuron Types of the Adult Murine Striatum.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Hibernate-A Medium ThermoFisher Cat#A1247501 Trypsin inhibitor from chicken egg white Sigma Cat#T9253-500MG Percoll Sigma Cat#P1644 DAPI (4’,6-Diamidine-20-phenylindole dihydrochloride) Sigma Cat#10236276001 Triton X-100 Sigma Cat#T8787 Betaine Sigma-Aldrich Cat#61962 Recombinant RNase inhibitor Clontech Cat2313A dNTP NEB Cat#N0447 SMARTScribe Reverse Transcriptase Clontech Cat#639538 DTT (dithiothreitol) ThermoFisher Cat#R0861 Lambda Exonuclease NEB Cat#M0262L RNase-away ThermoFisher Cat#10328011 Critical Commercial Assays RNAscope Fluorescent Multiplex Reagent Kit ACDBio Cat#320850 Papain Dissociation System Worthington Cat#LK003150 Nextera XT DNA Library Prep Kit Illumina Cat#FC-131-1024 KAPA Hifi HotStart ReadyMix Kapa Biosystems Cat#KK2602 Ampure XP beads Ampure XP beads Cat#A63880 BioAnalyzer High Sensitivity Chips Agilent Cat#5067-4626 Falcon Cell Strainers Fisher Cat#08-771-2 ERCC RNA Spike-In Mix Invitrogen Cat#4456740 Cryomold VWR Cat#15160-215 Deposited Data Mouse Brain Atlas Allen Institute http://mouse.brain-map.org/ Mouse Reference Genome GRCm38/mm10 UCSC Genome Browser http://genome.ucsc.edu/cgi-bin/ hgGateway?db=mm10 Raw and analyzed data This paper GEO: GSE139412 Experimental Models: Organisms/Strains Mouse: FVB.Cg-Tg(Drd1-tdTomato)5Calak/ Mmnc Mus musculus Malenka Laboratory RRID:MMRRC_030512-UNC Mouse: Wildtype: C57BL/6J Jackson Laboratory JAX: #000664 Mouse: Tg(Drd2-EGFP)S118Gsat/Mmnc Malenka Laboratory RRID:MMRRC_000230-UNC Oligonucleotides Template Switch Oligo (AAGCAGTGGTATCAACG CAGAGTGAATrGrG+G) IDT Picelli et al., 2014 IS_PCR primer (AAGCAGTGGTATCAACGCAGAGT) IDT Picelli et al., 2014 Oligo dT: (50-AAGCAGTGGTATCAACGC AGAGTACT30VN-30) IDT Picelli et al., 2014 RNAscope Mm-Tac1 probe ACD Biosciences Cat#410351 RNAscope Mm-Penk probe ACD Biosciences Cat#318761 RNAscope Mm-Tac2 probe ACD Biosciences Cat#446391 RNAscope Mm-Nxph4 probe ACD Biosciences Cat#489641 (Continued on next page) Neuron 105, 1–12.e1–e8, February 19, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNAscope Mm-Cnr1 probe ACD Biosciences Cat#420721 RNAscope Mm-Crym probe ACD Biosciences Cat#466131 RNAscope Mm-Sema5b probe ACD Biosciences N/A RNAscope Mm-Id4 probe ACD Biosciences Cat#447861 RNAscope Mm-Nts probe ACD Biosciences Cat#420441 RNAscope Mm-Synpr probe ACD Biosciences Cat#500961 RNAscope Mm-Dner probe ACD Biosciences Cat#413951 RNAscope Mm-Tnnt1 probe ACD Biosciences Cat#466911 RNAscope Mm-Cxcl14 probe ACD Biosciences Cat#459741 RNAscope Mm-Th probe ACD Biosciences Cat#317621 RNAscope Mm-Htr7 probe ACD Biosciences Cat#401321 RNAscope Mm-Kremen1 probe ACD Biosciences Cat#425771 Software and Algorithms Star v2.4.0, https://github.com/alexdobin/STAR HTSeq v0.11.1, https://htseq.readthedocs.io/ en/release_0.11.1/ R v3.5.1, http://www.r-project.org; RRID:SCR_001905 Python v3.6.6, https://www.python.org Scanpy v1.3.7, https://icb-scanpy.readthedocs- hosted.com/en/stable/ CellProfiler v2.2.1, https://cellprofiler.org/releases/ Seurat v2.3.4, https://satijalab.org/seurat/ spdep v1.1-3, https://cran.r-project.org/web/ packages/spdep/index.html Fiji ImageJ Open source https://fiji.sc/ N/A Samtools N/A v1.3, http://samtools.sourceforge.net/; RRID:SCR_002105 Integrative Genomics Viewer (IGV) N/A http://software.broadinstitute.org/ software/igv; RRID:SCR_011793 Other FACS (Aria II) BD Biosciences N/A NextSeq 500 Illumina N/A Leica CM 3050 S cryostat Leica N/A HybEZ II Hybridization System for Manual Assays ACDBio N/A

    RNAscope:

    Article Title: Continuous and Discrete Neuron Types of the Adult Murine Striatum.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Hibernate-A Medium ThermoFisher Cat#A1247501 Trypsin inhibitor from chicken egg white Sigma Cat#T9253-500MG Percoll Sigma Cat#P1644 DAPI (4’,6-Diamidine-20-phenylindole dihydrochloride) Sigma Cat#10236276001 Triton X-100 Sigma Cat#T8787 Betaine Sigma-Aldrich Cat#61962 Recombinant RNase inhibitor Clontech Cat2313A dNTP NEB Cat#N0447 SMARTScribe Reverse Transcriptase Clontech Cat#639538 DTT (dithiothreitol) ThermoFisher Cat#R0861 Lambda Exonuclease NEB Cat#M0262L RNase-away ThermoFisher Cat#10328011 Critical Commercial Assays RNAscope Fluorescent Multiplex Reagent Kit ACDBio Cat#320850 Papain Dissociation System Worthington Cat#LK003150 Nextera XT DNA Library Prep Kit Illumina Cat#FC-131-1024 KAPA Hifi HotStart ReadyMix Kapa Biosystems Cat#KK2602 Ampure XP beads Ampure XP beads Cat#A63880 BioAnalyzer High Sensitivity Chips Agilent Cat#5067-4626 Falcon Cell Strainers Fisher Cat#08-771-2 ERCC RNA Spike-In Mix Invitrogen Cat#4456740 Cryomold VWR Cat#15160-215 Deposited Data Mouse Brain Atlas Allen Institute http://mouse.brain-map.org/ Mouse Reference Genome GRCm38/mm10 UCSC Genome Browser http://genome.ucsc.edu/cgi-bin/ hgGateway?db=mm10 Raw and analyzed data This paper GEO: GSE139412 Experimental Models: Organisms/Strains Mouse: FVB.Cg-Tg(Drd1-tdTomato)5Calak/ Mmnc Mus musculus Malenka Laboratory RRID:MMRRC_030512-UNC Mouse: Wildtype: C57BL/6J Jackson Laboratory JAX: #000664 Mouse: Tg(Drd2-EGFP)S118Gsat/Mmnc Malenka Laboratory RRID:MMRRC_000230-UNC Oligonucleotides Template Switch Oligo (AAGCAGTGGTATCAACG CAGAGTGAATrGrG+G) IDT Picelli et al., 2014 IS_PCR primer (AAGCAGTGGTATCAACGCAGAGT) IDT Picelli et al., 2014 Oligo dT: (50-AAGCAGTGGTATCAACGC AGAGTACT30VN-30) IDT Picelli et al., 2014 RNAscope Mm-Tac1 probe ACD Biosciences Cat#410351 RNAscope Mm-Penk probe ACD Biosciences Cat#318761 RNAscope Mm-Tac2 probe ACD Biosciences Cat#446391 RNAscope Mm-Nxph4 probe ACD Biosciences Cat#489641 (Continued on next page) Neuron 105, 1–12.e1–e8, February 19, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNAscope Mm-Cnr1 probe ACD Biosciences Cat#420721 RNAscope Mm-Crym probe ACD Biosciences Cat#466131 RNAscope Mm-Sema5b probe ACD Biosciences N/A RNAscope Mm-Id4 probe ACD Biosciences Cat#447861 RNAscope Mm-Nts probe ACD Biosciences Cat#420441 RNAscope Mm-Synpr probe ACD Biosciences Cat#500961 RNAscope Mm-Dner probe ACD Biosciences Cat#413951 RNAscope Mm-Tnnt1 probe ACD Biosciences Cat#466911 RNAscope Mm-Cxcl14 probe ACD Biosciences Cat#459741 RNAscope Mm-Th probe ACD Biosciences Cat#317621 RNAscope Mm-Htr7 probe ACD Biosciences Cat#401321 RNAscope Mm-Kremen1 probe ACD Biosciences Cat#425771 Software and Algorithms Star v2.4.0, https://github.com/alexdobin/STAR HTSeq v0.11.1, https://htseq.readthedocs.io/ en/release_0.11.1/ R v3.5.1, http://www.r-project.org; RRID:SCR_001905 Python v3.6.6, https://www.python.org Scanpy v1.3.7, https://icb-scanpy.readthedocs- hosted.com/en/stable/ CellProfiler v2.2.1, https://cellprofiler.org/releases/ Seurat v2.3.4, https://satijalab.org/seurat/ spdep v1.1-3, https://cran.r-project.org/web/ packages/spdep/index.html Fiji ImageJ Open source https://fiji.sc/ N/A Samtools N/A v1.3, http://samtools.sourceforge.net/; RRID:SCR_002105 Integrative Genomics Viewer (IGV) N/A http://software.broadinstitute.org/ software/igv; RRID:SCR_011793 Other FACS (Aria II) BD Biosciences N/A NextSeq 500 Illumina N/A Leica CM 3050 S cryostat Leica N/A HybEZ II Hybridization System for Manual Assays ACDBio N/A

    Multiplex Assay:

    Article Title: Continuous and Discrete Neuron Types of the Adult Murine Striatum.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins Hibernate-A Medium ThermoFisher Cat#A1247501 Trypsin inhibitor from chicken egg white Sigma Cat#T9253-500MG Percoll Sigma Cat#P1644 DAPI (4’,6-Diamidine-20-phenylindole dihydrochloride) Sigma Cat#10236276001 Triton X-100 Sigma Cat#T8787 Betaine Sigma-Aldrich Cat#61962 Recombinant RNase inhibitor Clontech Cat2313A dNTP NEB Cat#N0447 SMARTScribe Reverse Transcriptase Clontech Cat#639538 DTT (dithiothreitol) ThermoFisher Cat#R0861 Lambda Exonuclease NEB Cat#M0262L RNase-away ThermoFisher Cat#10328011 Critical Commercial Assays RNAscope Fluorescent Multiplex Reagent Kit ACDBio Cat#320850 Papain Dissociation System Worthington Cat#LK003150 Nextera XT DNA Library Prep Kit Illumina Cat#FC-131-1024 KAPA Hifi HotStart ReadyMix Kapa Biosystems Cat#KK2602 Ampure XP beads Ampure XP beads Cat#A63880 BioAnalyzer High Sensitivity Chips Agilent Cat#5067-4626 Falcon Cell Strainers Fisher Cat#08-771-2 ERCC RNA Spike-In Mix Invitrogen Cat#4456740 Cryomold VWR Cat#15160-215 Deposited Data Mouse Brain Atlas Allen Institute http://mouse.brain-map.org/ Mouse Reference Genome GRCm38/mm10 UCSC Genome Browser http://genome.ucsc.edu/cgi-bin/ hgGateway?db=mm10 Raw and analyzed data This paper GEO: GSE139412 Experimental Models: Organisms/Strains Mouse: FVB.Cg-Tg(Drd1-tdTomato)5Calak/ Mmnc Mus musculus Malenka Laboratory RRID:MMRRC_030512-UNC Mouse: Wildtype: C57BL/6J Jackson Laboratory JAX: #000664 Mouse: Tg(Drd2-EGFP)S118Gsat/Mmnc Malenka Laboratory RRID:MMRRC_000230-UNC Oligonucleotides Template Switch Oligo (AAGCAGTGGTATCAACG CAGAGTGAATrGrG+G) IDT Picelli et al., 2014 IS_PCR primer (AAGCAGTGGTATCAACGCAGAGT) IDT Picelli et al., 2014 Oligo dT: (50-AAGCAGTGGTATCAACGC AGAGTACT30VN-30) IDT Picelli et al., 2014 RNAscope Mm-Tac1 probe ACD Biosciences Cat#410351 RNAscope Mm-Penk probe ACD Biosciences Cat#318761 RNAscope Mm-Tac2 probe ACD Biosciences Cat#446391 RNAscope Mm-Nxph4 probe ACD Biosciences Cat#489641 (Continued on next page) Neuron 105, 1–12.e1–e8, February 19, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNAscope Mm-Cnr1 probe ACD Biosciences Cat#420721 RNAscope Mm-Crym probe ACD Biosciences Cat#466131 RNAscope Mm-Sema5b probe ACD Biosciences N/A RNAscope Mm-Id4 probe ACD Biosciences Cat#447861 RNAscope Mm-Nts probe ACD Biosciences Cat#420441 RNAscope Mm-Synpr probe ACD Biosciences Cat#500961 RNAscope Mm-Dner probe ACD Biosciences Cat#413951 RNAscope Mm-Tnnt1 probe ACD Biosciences Cat#466911 RNAscope Mm-Cxcl14 probe ACD Biosciences Cat#459741 RNAscope Mm-Th probe ACD Biosciences Cat#317621 RNAscope Mm-Htr7 probe ACD Biosciences Cat#401321 RNAscope Mm-Kremen1 probe ACD Biosciences Cat#425771 Software and Algorithms Star v2.4.0, https://github.com/alexdobin/STAR HTSeq v0.11.1, https://htseq.readthedocs.io/ en/release_0.11.1/ R v3.5.1, http://www.r-project.org; RRID:SCR_001905 Python v3.6.6, https://www.python.org Scanpy v1.3.7, https://icb-scanpy.readthedocs- hosted.com/en/stable/ CellProfiler v2.2.1, https://cellprofiler.org/releases/ Seurat v2.3.4, https://satijalab.org/seurat/ spdep v1.1-3, https://cran.r-project.org/web/ packages/spdep/index.html Fiji ImageJ Open source https://fiji.sc/ N/A Samtools N/A v1.3, http://samtools.sourceforge.net/; RRID:SCR_002105 Integrative Genomics Viewer (IGV) N/A http://software.broadinstitute.org/ software/igv; RRID:SCR_011793 Other FACS (Aria II) BD Biosciences N/A NextSeq 500 Illumina N/A Leica CM 3050 S cryostat Leica N/A HybEZ II Hybridization System for Manual Assays ACDBio N/A



    Similar Products

    2313a dntp neb cat  (New England Biolabs)
    99
    New England Biolabs 2313a dntp neb cat
    2313a Dntp Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2313a+dntp+neb+cat/Deoxynucleotide+(dNTP)+Solution+Mix/pm31813651-245-41-43
    Average 99 stars, based on 1 article reviews
    2313a dntp neb cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results